Encomenda rápida

Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PDCD4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_014456.3
Tamanho de cDNA:1410 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1.
Sinónimo de gene:H731
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-PDCD4
Local de restrição:KpnI + XbaI(6.1kb+1.41kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PDCD4 qPCR primers for gene expression analysis, HP101098 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11193-ACG$225
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11193-ACR$225
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11193-ANG$225
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11193-ANR$225
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11193-CF$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11193-CH$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11193-CM$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11193-CY$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11193-M$75
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11193-NF$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11193-NH$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11193-NM$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11193-NY$195
Humano PDCD4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11193-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11193-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"