After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PARVA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC016713
Tamanho de cDNA:1119bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens parvin, alpha with C terminal Flag tag.
Sinónimo de gene:MXRA2, CH-ILKBP
Espécie:Human
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13919-ACG$225
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13919-ACR$225
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13919-ANG$225
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13919-ANR$225
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13919-CF$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13919-CH$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13919-CM$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13919-CY$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de expressão)HG13919-G$75
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13919-NF$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13919-NH$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13919-NM$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13919-NY$195
Humano Actopaxin clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13919-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.

Referências
  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • Size / Price
    Catálogo: HG13919-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"