Encomenda rápida

Text Size:AAA

Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PAH Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1359bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens phenylalanine hydroxylase with C terminal HA tag.
Sinónimo de gene:PH, PKU, PKU1, PAH
Local de restrição:KpnI + NotI (6kb + 1.4kb)
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 696 A/G, 735 G/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human PAH Gene Plasmid Map
Human PAH natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12081-ACG$225
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12081-ACR$225
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12081-ANG$225
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12081-ANR$225
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12081-CF$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12081-CH$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12081-CM$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12081-CY$195
Human PAH Gene cDNA clone plasmidHG12081-G$125
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12081-NF$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12081-NH$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12081-NM$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12081-NY$195
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de expressão)HG12081-U$75
Humano PAH / PH clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12081-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

PAH (phenylalanine hydroxylase), also known as PH, belongs to the biopterin-dependent aromatic amino acid hydroxylase family. It contains 1 ACT domain, N-terminal region of PAH is thought to contain allosteric binding sites for phenylalanine and to constitute an "inhibitory" domain that regulates the activity of a catalytic domain in the C-terminal portion of the molecule. In humans, PAH is expressed both in the liver and the kidney, and there is some indication that it may be differentially regulated in these tissues. PAH catalyzes the hydroxylation of the aromatic side-chain of phenylalanine to generate tyrosine. It is one of three members of the pterin-dependent amino acid hydroxylases, a class of monooxygenase that uses tetrahydrobiopterin and a non-heme iron for catalysis. Defects in PAH are the cause of phenylketonuria (PKU). PKU is an autosomal recessive inborn error of phenylalanine metabolism, due to severe phenylalanine hydroxylase deficiency. It is characterized by blood concentrations of phenylalanine persistently above 1200 mumol.

  • Fitzpatrick PF, et al. (1999) Tetrahydropterin-dependent amino acid hydroxylases. Annu Rev Biochem. 68:355-81.
  • Olsson E, et al. (2011) Formation of the iron-oxo hydroxylating species in the catalytic cycle of aromatic amino acid hydroxylases. Chemistry. 17(13):3746-58.
  • Bassan A, et al. (2003) Mechanism of aromatic hydroxylation by an activated FeIVO core in tetrahydrobiopterin-dependent hydroxylases. Chemistry. 9(17):4055-67.
  • Panay AJ, et al. (2011) Evidence for a high-spin Fe(IV) species in the catalytic cycle of a bacterial phenylalanine hydroxylase. Biochemistry. 50(11):1928-33.
  • Bassan A, et al. (2003) Mechanism of dioxygen cleavage in tetrahydrobiopterin-dependent amino acid hydroxylases. Chemistry. 9(1):106-15.
  • Size / Price
    Catálogo: HG12081-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Human PAH natural ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.