After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human OAT Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000274.3
Tamanho de cDNA:1320bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ornithine aminotransferase.
Sinónimo de gene:OKT, GACR, HOGA, OATASE
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG16152-ACG$225
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG16152-ACR$225
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG16152-ANG$225
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG16152-ANR$225
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG16152-CF$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG16152-CH$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG16152-CM$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG16152-CY$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de expressão)HG16152-G$75
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG16152-NF$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG16152-NH$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG16152-NM$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG16152-NY$195
Humano OAT/ornithine aminotransferase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG16152-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG16152-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"