After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Human NRAS ORF mammalian expression plasmid, N-Flag tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human NRAS Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002524
Tamanho de cDNA:570bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens neuroblastoma RAS viral (v-ras) oncogene homolog with N terminal Flag tag.
Sinónimo de gene:NS6, ALPS4, N-ras, NRAS1, NRAS
Espécie:Human
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fundo

NRAS was discovered by researchers at the Institute of Cancer Research, funded by the Cancer Research Campaign (now Cancer Research UK). NRAS gene is a member of the Ras gene family. It is mapped on chromosome 1, and it is activated in HL60, a promyelocytic leukemia line. The mammalian ras gene family consists of the harvey and kirsten ras genes (HRAS and KRAS), an inactive pseudogene of each (c-Hras2 and c-Kras1) and the N-ras gene. They differ significantly only in the C-terminal 40 amino acids. These ras genes have GTP/GDP binding and GTPase activity, and their normal function may be as G-like regulatory proteins involved in the normal control of cell growth. The NRAS gene specifies two main transcripts of 2Kb and 4.3Kb. The difference between the two transcripts is a simple extension through the termination site of the 2Kb transcript. The NRAS gene consists of seven exons (-I, I, II, III, IV, V, VI).

Referências
  • Marshall CJ. et al., 1982, Nature. 299 (5879): 171-3.
  • Hall Alan. et al., 1983, Nature. 303 (5916): 396-400.
  • McCormick F. 1996, Mol Reprod Dev. 42 (4): 500-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"