Encomenda rápida

Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano NPM1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_002520
    Tamanho de cDNA:885bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with C terminal HA tag.
    Sinónimo de gene:B23, NPM
    Espécie:Human
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NPM1 qPCR primers for gene expression analysis, HP101603 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12074-ACG$225
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12074-ACR$225
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12074-ANG$225
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12074-ANR$225
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12074-CF$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12074-CH$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12074-CM$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12074-CY$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12074-G$75
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12074-NF$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12074-NH$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12074-NM$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12074-NY$195
    Humano NPM1/Nucleophosmin transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12074-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

    Referências
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Catálogo: HG12074-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"