After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human NLGN3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_018977.2
Tamanho de cDNA:2487bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens neuroligin 3 with C terminal HA tag.
Sinónimo de gene:HNL3, ASPGX1, AUTSX1, KIAA1480, NLGN3
Espécie:Human
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11160-ACG$245
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11160-ACR$245
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11160-CF$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11160-CH$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11160-CM$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11160-CY$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11160-M$75
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11160-M-F$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11160-NF$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11160-NH$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11160-NM$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11160-NY$215
Humano Neuroligin 3 / NLGN3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11160-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Neuroligin 3 (NLGN3) is a member of the type-B carboxylesterase/lipase family. Neuroligins (NLGNs) are a family of presumptive postsynaptic cell adhesion molecules. Neuroligins (NLs) constitute a family of cell-surface proteins that interact with neurexins (beta-Nxs), another class of neuronal cell-surface proteins, one of each class functioning together in synapse formation. Neuroligins control the formation and functional balance of excitatory and inhibitory synapses in hippocampal neurons. NLGN1 and NLGN2 isoforms are concentrated at glutamatergic and GABAergic synapses, respectively, but the cellular expression and synaptic localization of the endogenous. NLGN3 was enriched in brain, where NLGN3 protein levels increased during postnatal development, coinciding with the peak of synaptogenesis. The NLGN3 is a synaptic adhesion molecule that is a shared component of glutamatergic and GABAergic synapses. Mutations in NLGN3 gene may be associated with autism and Asperger syndrome.

Referências
  • Chih B, et al. (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science. 307(5713): 1324-8.
  • Paraoanu LE, et al. (2006) Expression patterns of neurexin-1 and neuroligins in brain and retina of the chick embryo: Neuroligin-3 is absent in retina. Neurosci Lett. 395(2): 114-7.
  • Budreck EC, et al. (2007) Neuroligin-3 is a neuronal adhesion protein at GABAergic and glutamatergic synapses. Eur J Neurosci. 26(7): 1738-48.
  • Size / Price
    Catálogo: HG11160-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"