After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human NEK3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_152720.1
Tamanho de cDNA:1521bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2.
Sinónimo de gene:HSPK36, MGC29949, NEK3
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-NEK3
Local de restrição:KpnI + XbaI (6.1kb + 1.52kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human NEK3 Gene Plasmid Map
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10675-ACG$245
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10675-ACR$245
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10675-ANG$245
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10675-ANR$245
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10675-CF$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10675-CH$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10675-CM$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10675-CY$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10675-M$75
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10675-M-F$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10675-NF$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10675-NH$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10675-NM$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10675-NY$215
Humano NEK3 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10675-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

Referências
  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • Size / Price
    Catálogo: HG10675-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"