After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human NCAM1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001076682.2
Tamanho de cDNA:2286bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens neural cell adhesion molecule 1.
Sinónimo de gene:CD56, NCAM, MSK39, NCAM1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10673-ACG$245
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10673-ACR$245
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10673-CF$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10673-CH$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10673-CM$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10673-CY$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10673-M$75
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10673-M-F$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10673-M-N$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10673-NF$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10673-NH$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10673-NM$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10673-NY$215
Humano NCAM1 / CD56 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10673-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

Referências
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    Catálogo: HG10673-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"