After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MVK Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC016140
Tamanho de cDNA:1191bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens mevalonate kinase with C terminal Flag tag.
Sinónimo de gene:MK, LRBP, MVLK, POROK3
Espécie:Human
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13923-ACG$225
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13923-ACR$225
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13923-ANG$225
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13923-ANR$225
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13923-CF$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13923-CH$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13923-CM$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13923-CY$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de expressão)HG13923-G$75
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13923-NF$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13923-NH$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13923-NM$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13923-NY$195
Humano Mevalonate kinase / MVK clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13923-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.

Referências
  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • Size / Price
    Catálogo: HG13923-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"