Encomenda rápida

Humano MTMR6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

  • Cynomolgus LOC101926731 Gene Plasmid Map 5628
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano MTMR6 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC040012
Tamanho de cDNA:1908 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens myotubularin related protein 6 with N terminal HA tag.
Sinónimo de gene:MTMR6
Espécie:Human
Vetor:pCMV3-N-HA
Plasmid:pCMV3-HA-MTMR6
Local de restrição:KpnI + XbaI(6kb+1.91kb)
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MTMR6 qPCR primers for gene expression analysis, HP103818 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano MTMR6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: HG15192-NY
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"