After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MST4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_016542.3
Tamanho de cDNA:1251bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens serine/threonine protein kinase MST4.
Sinónimo de gene:MST4, MASK
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10667-ACG$225
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10667-ACR$225
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10667-ANG$225
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10667-ANR$225
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10667-CF$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10667-CH$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10667-CM$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10667-CY$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10667-M$75
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10667-M-F$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10667-M-N$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10667-NF$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10667-NH$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10667-NM$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10667-NY$195
Humano MST4/MST-4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10667-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

Referências

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Size / Price
Catálogo: HG10667-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"