Encomenda rápida

Text Size:AAA

Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MOB1B Informações sobre o produto de clone de cDNA
Tamanho de cDNA:651bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens MOB kinase activator 1B with C terminal His tag.
Sinónimo de gene:MATS2, MOB4A, MOBKL1A
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14016-ACG$225
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14016-ACR$225
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14016-ANG$225
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14016-ANR$225
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14016-CF$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14016-CH$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14016-CM$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14016-CY$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de expressão)HG14016-G$75
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14016-NF$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14016-NH$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14016-NM$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14016-NY$195
Humano MOB1B / MOBKL1A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14016-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

MST1 and MST2 are the mammalian Ste20-related protein kinases most closely related to Drosophila Hippo, a major regulator of cell proliferation and survival during development. Overexpression of MST1 or MST2 in mammalian cells is proapototic. MST1 and MST2 activity increases during mitosis, especially in nocodazole-arrested mitotic cells, where these kinases exhibit both an increase in both abundance and activation. MST1 and MST2 also can be activated nonphysiologically by okadaic acid or H2O2. The MOB1B and MOBKL1B polypeptides, homologs of the Drosophila MATS polypeptide, are identified as preferred MST1/MST2 substrates in vitro and are phosphorylated in cells in an MST1/MST2-dependent manner in mitosis and in response to okadaic acid or H2O2. MST1/MST2-catalyzed MOB1B/MOBKL1B phosphorylation alters the ability of MOB1B/MOBKL1B to bind and regulate downstream targets such as the NDR-family protein kinases. Thus, MOB1B/MOBKL1B phosphorylation in cells promotes MOB1B/MOBKL1B binding to the LATS1 kinase and enables H2O2-stimulated LATS1 activation loop phosphorylation. Most importantly, replacement of endogenous MOB1B/MOBKL1B by a nonphosphorylatable mutant is sufficient to accelerate cell proliferation substantially by speeding progression through G1/S as well as mitotic exit.

  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Devroe E, et al. (2004) Human Mob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J Biol Chem. 279(23):24444-51.
  • Praskova M, et al. (2008) MOB1B/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol. 18(5):311-21.
  • Size / Price
    Catálogo: HG14016-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.