Encomenda rápida

Humano MMGT1 / EMC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MMGT1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:396bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens membrane magnesium transporter 1 with C terminal His tag.
Sinónimo de gene:EMC5, TMEM32, MMGT1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

MMGT1, also known as EMC5, is comparable with primary microglial cells with respect to morphology, presence of acetylated low density lipoprotein receptor, non-specific esterase, CD63, major histocompatibility complex antigens and CD11, and binding for Ricinus communis agglutinin. Primary microglia as well as MMGT1 cells are negative for glial fibrillary acidic protein. Different MMGT1 strains are obtained after subcloning, two of which resembled histiocytes (F4/80 and BM-8). These cell strains, MMGT12 and 16, are able to opsonize latex beads, and could be induced by endotoxins (LPS) to secrete TNF-alpha, IL-1, IL-6, TGF-beta, and EGF.

  • Goytain A. et al., 2008, Am J Physiol Cell Physiol. 294 (2): C495-502.
  • Briers TW. et al., 1994, J Neuroimmunol. 52 (2): 153-64.
  • Jäger S. et al., 2011, Nature. 481 (7381): 365-70.
  • Size / Price
    Catálogo: HG13998-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.