Encomenda rápida

Humano MID1IP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano MID1IP1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC008908
    Tamanho de cDNA:552bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens MID1 interacting protein 1 with C terminal His tag.
    Sinónimo de gene:S14R, MIG12, THRSPL, G12-like, STRAIT11499, MID1IP1
    Espécie:Human
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MID1IP1 qPCR primers for gene expression analysis, HP102661 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano MID1IP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Product nameProduct name
    Fundo

    MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

    Referências
  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"