After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano MGAT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MGAT5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002410.3
Tamanho de cDNA:2226bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase with N terminal His tag.
Sinónimo de gene:GNT-V, GNT-VA, MGAT5
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fundo

Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A, also known as Alpha-mannoside beta-1,6-N-acetylglucosaminyl-transferase, Mannoside acetylglucosaminyltransferase 5, N-acetylglucosaminyl-transferase V, MGAT5 and GGNT5, is a single-pass type I I membrane protein which belongs to the glycosyltransferase 18 family. MGAT5 / GGNT5 catalyzes the addition of N-acetylglucosamine in beta 1-6 linkage to the alpha-linked mannose of biantennary N-linked oligosaccharides. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. The central nervous system (CNS) is rich in glycoconjugates, located on cell surface and in extracellular matrix. MGAT5 / GGNT5 modification of complex-type N-glycans on CNS glycoproteins is involved in the regulation of depression-like behavior. Inhibitors of MGAT5 / GGNT5 might be useful in the treatment of malignancies by targeting their dependency on focal adhesion signaling for growth and metastasis.

Referências
  • Morgan,R. et al., 2004,J Immunol  173 (12): 7200-8.
  • Cheung,P. et al., 2007,Glycobiology  17 (7): 767-73.
  • Li,D. et al., 2008, J Immunol 180 (5): 3158-65.
  • Soleimani,L. et al., 2008, Genes Brain Behav. 7 (3):334-43.
  • Size / Price
    Catálogo: HG11373-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"