After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MAP2K1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002755.3
Tamanho de cDNA:1182bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 1.
Sinónimo de gene:MEK1, MKK1, MAPKK1, PRKMK1, MAP2K1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10661-ACG$225
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10661-ACR$225
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10661-ANG$225
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10661-ANR$225
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10661-CF$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10661-CH$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10661-CM$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10661-CY$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10661-M$75
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10661-M-N$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10661-NF$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10661-NH$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10661-NM$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10661-NY$195
Humano MEK1/MAP2K1/MKK1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10661-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.

Referências
  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.
  • Size / Price
    Catálogo: HG10661-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"