Encomenda rápida

Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano MAPK8 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1284bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Myc tag.
    Sinónimo de gene:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with MAPK8 qPCR primers for gene expression analysis, HP100709 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10795-ACG$225
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10795-ACR$225
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10795-ANG$225
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10795-ANR$225
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10795-CF$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10795-CH$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10795-CM$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10795-CY$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10795-M$75
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10795-M-F$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10795-M-N$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10795-NF$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10795-NH$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10795-NM$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10795-NY$195
    Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10795-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.