After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MAPK13 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002754.3
Tamanho de cDNA:1098bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 13 with N terminal His tag.
Sinónimo de gene:SAPK4, PRKM13, MGC99536, p38delta, MAPK13
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10747-ACG$225
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10747-ACR$225
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10747-ANG$225
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10747-ANR$225
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10747-CF$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10747-CH$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10747-CM$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10747-CY$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10747-M$75
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10747-M-F$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10747-NF$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10747-NH$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10747-NM$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10747-NY$195
Humano p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10747-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.

Referências
  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • Size / Price
    Catálogo: HG10747-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"