Encomenda rápida

Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MAP3K8 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1404bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase kinase 8 with N terminal Myc tag.
Sinónimo de gene:COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10800-ACG$225
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10800-ACR$225
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10800-ANG$225
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10800-ANR$225
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10800-CF$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10800-CH$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10800-CM$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10800-CY$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10800-M$75
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10800-M-H$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10800-NF$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10800-NH$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10800-NM$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10800-NY$195
Humano TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10800-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    Catálogo: HG10800-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.