LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12058-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All LMNA Reagents

CRO Services

Product recommended


All LMNA Reagents

LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1995 bp
Description
Full length Clone DNA of Human lamin A/C with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

CDCD1 cDNA ORF Clone, Human;CDDC cDNA ORF Clone, Human;CMD1A cDNA ORF Clone, Human;CMT2B1 cDNA ORF Clone, Human;EMD2 cDNA ORF Clone, Human;FPL cDNA ORF Clone, Human;FPLD cDNA ORF Clone, Human;FPLD2 cDNA ORF Clone, Human;HGPS cDNA ORF Clone, Human;IDC cDNA ORF Clone, Human;LDP1 cDNA ORF Clone, Human;LFP cDNA ORF Clone, Human;LGMD1B cDNA ORF Clone, Human;LMN1 cDNA ORF Clone, Human;LMNC cDNA ORF Clone, Human;LMNL1 cDNA ORF Clone, Human;PRO1 cDNA ORF Clone, Human

LMNA Background Information

Mutations of the LMNA gene encoding the lamin A and C nuclear envelope proteins cause an autosomal dominant form of dilated cardiomyopathy (DCM) with atrioventricular block (AVB). LMNA mutations can also lead to several other disorders, collectively termed laminopathies, involving heart, fat, nerve, bone, and skin tissues, and some premature ageing syndromes.Mutations of the LMNA gene have been shown to cause an autosomal dominant form of insulin resistance with familial partial lipodystrophy (PLD), frequently accompanied by diabetes. LMNA mutations are considered to be a rare cause of monogenic diabetes; however, they are probably sometimes misdiagnosed as type 2 diabetes (T2DM).
Full Name
lamin A/C

LMNA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LMNA cDNA ORF Clone in Cloning Vector, Mouse MG51713-G
LMNA cDNA ORF Clone, Mouse, untagged MG51713-UT
LMNA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51713-ACG
LMNA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51713-ACGLN
LMNA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51713-ANG
LMNA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51713-ACR
LMNA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51713-ANR
LMNA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51713-CF
LMNA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51713-NF
LMNA cDNA ORF Clone, Mouse, C-His tag MG51713-CH
LMNA cDNA ORF Clone, Mouse, N-His tag MG51713-NH
LMNA cDNA ORF Clone, Mouse, C-HA tag MG51713-CY
LMNA cDNA ORF Clone, Mouse, N-HA tag MG51713-NY
LMNA cDNA ORF Clone, Mouse, C-Myc tag MG51713-CM
LMNA cDNA ORF Clone, Mouse, N-Myc tag MG51713-NM
LMNA qPCR Primer Pairs, Mouse MP201586

LMNA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LMNA cDNA ORF Clone in Cloning Vector, Human HG12058-G
LMNA cDNA ORF Clone, Human, untagged HG12058-UT
LMNA cDNA ORF Clone, Human, C-GFPSpark® tag HG12058-ACG
LMNA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12058-ACGLN
LMNA cDNA ORF Clone, Human, N-GFPSpark® tag HG12058-ANG
LMNA cDNA ORF Clone, Human, C-OFPSpark® tag HG12058-ACR
LMNA cDNA ORF Clone, Human, N-OFPSpark® tag HG12058-ANR
LMNA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12058-CF
LMNA cDNA ORF Clone, Human, C-His tag HG12058-CH
LMNA cDNA ORF Clone, Human, N-His tag HG12058-NH
LMNA cDNA ORF Clone, Human, C-HA tag HG12058-CY
LMNA cDNA ORF Clone, Human, N-HA tag HG12058-NY
LMNA cDNA ORF Clone, Human, C-Myc tag HG12058-CM
LMNA cDNA ORF Clone, Human, N-Myc tag HG12058-NM
LMNA qPCR Primer Pairs, Human HP101589
info info
添加购物车成功! 添加购物车失败!