Encomenda rápida

Text Size:AAA

Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human LMNA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1995bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens lamin A/C with C terminal His tag.
Sinónimo de gene:HGPS
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12058-ACG$245
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12058-ACR$245
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12058-ANG$245
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12058-ANR$245
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12058-CF$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12058-CH$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12058-CM$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12058-CY$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de expressão)HG12058-G$75
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12058-NF$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12058-NH$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12058-NM$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12058-NY$215
Humano LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12058-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG12058-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.