After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human LIF Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002309.4
Tamanho de cDNA:609bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens leukemia inhibitory factor with N terminal Myc tag.
Sinónimo de gene:CDF, DIA, HILDA, MLPLI
Espécie:Human
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14890-ACG$225
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14890-ACR$225
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14890-CF$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14890-CH$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14890-CM$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14890-CY$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de expressão)HG14890-G$75
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14890-NF$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14890-NH$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14890-NM$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14890-NY$195
Humano Leukemia Inhibitory Factor/LIF clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14890-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.

Referências
  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.
  • Size / Price
    Catálogo: HG14890-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"