Encomenda rápida

Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano LGALS14 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_020129.2
    Tamanho de cDNA:420bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1 with N terminal His tag.
    Sinónimo de gene:CLC2, PPL13, MGC22235, LGALS14
    Espécie:Human
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGALS14 qPCR primers for gene expression analysis, HP101253 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11371-ACG$225
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11371-ACR$225
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11371-ANG$225
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11371-ANR$225
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11371-CF$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11371-CH$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11371-CM$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11371-CY$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11371-M$75
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11371-M-F$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11371-NF$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11371-NH$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11371-NM$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11371-NY$195
    Humano Galectin-14/LGALS14 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11371-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG11371-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"