After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human LCA5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC050327
Tamanho de cDNA:2094bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens Leber congenital amaurosis 5.
Sinónimo de gene:C6orf152
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15199-ACG$245
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15199-ACR$245
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15199-ANG$245
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15199-ANR$245
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15199-CF$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15199-CH$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15199-CM$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15199-CY$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de expressão)HG15199-G$75
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15199-NF$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15199-NH$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15199-NM$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15199-NY$215
Humano LCA5/Lebercilin clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15199-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15199-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"