Encomenda rápida

Text Size:AAA

Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human LBP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1446bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with N terminal HA tag.
Sinónimo de gene:MGC22233
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10526-ACG$225
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10526-ACR$225
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10526-CF$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10526-CH$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10526-CM$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10526-CY$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de expressão)HG10526-M$75
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10526-M-F$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10526-NF$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10526-NH$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10526-NM$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10526-NY$195
Humano Lipopolysaccharide binding Proteína/LBP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10526-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Catálogo: HG10526-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.