Encomenda rápida

Humano KRT14 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human KRT14 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1419bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens keratin 14 with N terminal Myc tag.
Sinónimo de gene:K14, NFJ, CK14, EBS3, EBS4, KRT14
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano KRT14 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

Cytokeratin 14, also known as Keratin 14 and K14, is a member of the keratin family. Cytokeratin 14 is a type I keratin. It is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Cytokeratin 14 is mainly expressed in the basal layer. It is also strongly expressed in the outer root sheath of anagen follicles. Cytokeratin 14 and keratin 5 may have a role in maintenance of cell proliferation potential in the basal layer of stratified epithelia, modulating phosphatidylinositol 3-kinase/Akt–mediated cell proliferation and/or Notch1-dependent cell differentiation. Cytokeratin 14 defect prevents it from working effectively with keratin 5 and interfering with the assembly of the keratin intermediate filament network. A disruption in this network makes keratinocytes fragile and prone to rupture. Minor trauma to the skin, such as rubbing or scratching, can cause these cells to break down, resulting in the formation of painful, fluid-filled blisters. Mutations in the K14 gene are also responsible for Naegeli-Franceschetti-Jadassohn syndrome and dermatopathia pigmentosa reticularis.

  • Coulombe PA, et al., 1991, Cell. 66(6): 1301-11.
  • Schweizer J, et al., 2006, 174(2): 169-74.
  • Lugassy J, et al., 2006, Am J Hum Genet. 79(4): 724-30.
  • Size / Price
    Catálogo: HG13109-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.