Encomenda rápida

Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human KDM3B Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2280bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens lysine (K)-specific demethylase 3B with N terminal Myc tag.
Sinónimo de gene:5qNCA, NET22, C5orf7, JMJD1B, KDM3B
Local de restrição:HindIII(two restriction sites) + XbaI (6kb + 0.86kb + 1.48kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human KDM3B Gene Plasmid Map
Human KDM3B ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14315-ACG$245
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14315-ACR$245
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14315-ANG$245
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14315-ANR$245
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14315-CF$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14315-CH$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14315-CM$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14315-CY$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de expressão)HG14315-G$75
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14315-NF$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14315-NH$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14315-NM$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14315-NY$215
Humano KDM3B / JMJD1B clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14315-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.