Encomenda rápida

Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano JUP Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_006721878.1
Tamanho de cDNA:2238bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens junction plakoglobin.
Sinónimo de gene:DP3; PDGB; PKGB; CTNNG; DPIII; ARVD12
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with JUP qPCR primers for gene expression analysis, HP101556 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12020-ACG$245
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12020-ACR$245
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12020-ANG$245
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12020-ANR$245
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12020-CF$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12020-CH$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12020-CM$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12020-CY$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de expressão)HG12020-G$75
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12020-NF$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12020-NH$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12020-NM$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12020-NY$215
Humano γ-Catenin/JUP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12020-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG12020-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"