Encomenda rápida

Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human JTB Informações sobre o produto de clone de cDNA
Tamanho de cDNA:441bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens jumping translocation breakpoint with C terminal HA tag.
Sinónimo de gene:PAR, hJT, HJTB, HSPC222, JTB
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13447-ACG$225
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13447-ACR$225
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13447-CF$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13447-CH$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13447-CM$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13447-CY$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de expressão)HG13447-G$75
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13447-NF$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13447-NH$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13447-NM$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13447-NY$195
Humano jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13447-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catálogo: HG13447-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.