Encomenda rápida

Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

  • Human PKM2 Gene Plasmid Map 5788
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano MAPK9 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1320 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 9 with N terminal His tag.
Sinónimo de gene:JNK2, SAPK, p54a, JNK2A, JNK2B, PRKM9, JNK-55, JNK2BETA, p54aSAPK, JNK2ALPHA, MAPK9
Local de restrição:KpnI + NotI(6kb+1.32kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
( We provide with MAPK9 qPCR primers for gene expression analysis, HP100678 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10745-ACG$225
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10745-ACR$225
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10745-ANG$225
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10745-ANR$225
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10745-CF$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10745-CH$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10745-CM$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10745-CY$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10745-M$75
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10745-M-F$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10745-M-N$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10745-NF$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10745-NH$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10745-NM$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10745-NY$195
Humano JNK2/MAPK9 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10745-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Mitogen-activated protein kinase 9 (MAPK9), also well known as c-Jun N-terminal kinase (JNK2), is a member of MAP kinase subfamily belonging to the protein kinase superfamily. MAPK9 responds to activation by environmental stress and pro-inflammatory cytokines by phosphorylating a number of transcription factors, such as c-Jun and ATF2. The crystal structure of human JNK2 complexed with an indazole inhibitor by applying a high-throughput protein engineering and surface-site mutagenesis approach. A novel conformation of the activation loop is observed, which is not compatible with its phosphorylation by upstream kinases. This activation inhibitory conformation of JNK2 is stabilized by the MAP kinase insert that interacts with the activation loop in an induced-fit manner. It suggest that the MAP kinase insert of JNK2 plays a role in the regulation of JNK2 activation, possibly by interacting with intracellular binding partners. JNK2 deficiency leads to reduced c-Jun degradation, thereby augmenting c-Jun levels and cellular proliferation, and suggests that JNK2 is a negative regulator of cellular proliferation in multiple cell types. JNK2 prevents replicative stress by coordinating cell cycle progression and DNA damage repair mechanisms. JNK2 blocks the ubiquitination of tumor suppressor p53, and thus increases the stability of p53 in nonstressed cells. JNK2 negatively regulates antigen-specific CD8+ T cell expansion and effector function, and thus selectively blocking JNK2 in CD8+ T cells may potentially enhance anti-tumor immune response. Lack of JNK2 expression was associated with higher tumor aneuploidy and reduced DNA damage response. Additionally,the JNK2 protein could be a novel therapeutic target in dry eye disease, and may provide a novel target for prevention of vascular disease and atherosclerosis.

  • Sabapathy K, et al. (2004) JNK2: a negative regulator of cellular proliferation. Cell Cycle. 3(12): 1520-3.
  • Tao J, et al. (2007) JNK2 negatively regulates CD8+ T cell effector function and anti-tumor immune response. Eur J Immunol. 37(3): 818-29.
  • Shaw D, et al. (2008) The crystal structure of JNK2 reveals conformational flexibility in the MAP kinase insert and indicates its involvement in the regulation of catalytic activity. J Mol Biol. 383(4): 885-93.
  • Osto E, et al. (2008) c-Jun N-terminal kinase 2 deficiency protects against hypercholesterolemia-induced endothelial dysfunction and oxidative stress. 118(20): 2073-80.
  • De Paiva CS, et al. (2009) Essential role for c-Jun N-terminal kinase 2 in corneal epithelial response to desiccating stress. Arch Ophthalmol. 127(12): 1625-31.
  • Chen P, et al. (2010) Jnk2 effects on tumor development, genetic instability and replicative stress in an oncogene-driven mouse mammary tumor model. PLoS One. 5(5): e10443.
  • Size / Price
    Catálogo: HG10745-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.