Encomenda rápida

Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human JAM2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:897bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens junctional adhesion molecule 2 with C terminal Myc tag.
Sinónimo de gene:JAMB, CD322, JAM-B, VEJAM, PRO245, VE-JAM, C21orf43
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10580-ACG$225
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10580-ACR$225
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10580-CF$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10580-CH$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10580-CM$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10580-CY$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de expressão)HG10580-M$75
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10580-M-F$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10580-NF$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10580-NH$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10580-NM$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10580-NY$195
Humano Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10580-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Catálogo: HG10580-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.