After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ITK Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_005546.3
Tamanho de cDNA:1863bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens IL2-inducible T-cell kinase with N terminal His tag.
Sinónimo de gene:ITK, EMT, LYK, PSCTK2, MGC126257, MGC126258
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10104-ACG$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10104-ACR$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10104-ANG$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10104-ANR$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10104-CF$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10104-CH$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10104-CM$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10104-CY$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de expressão)HG10104-M$75
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10104-NF$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10104-NH$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10104-NM$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10104-NY$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10104-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

Referências
  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    Catálogo: HG10104-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"