Encomenda rápida

Text Size:AAA

Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ITK Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1863bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens IL2-inducible T-cell kinase with N terminal His tag.
Sinónimo de gene:ITK, EMT, LYK, PSCTK2, MGC126257, MGC126258
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10104-ACG$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10104-ACR$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10104-ANG$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10104-ANR$245
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10104-CF$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10104-CH$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10104-CM$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10104-CY$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de expressão)HG10104-M$75
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10104-NF$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10104-NH$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10104-NM$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10104-NY$215
Humano ITK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10104-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    Catálogo: HG10104-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.