Encomenda rápida

Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IPO11 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2928bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens importin 11 with C terminal His tag.
Sinónimo de gene:RanBP11, IPO11
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13382-ACG$325
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13382-ACR$325
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13382-ANG$325
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13382-ANR$325
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13382-CF$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13382-CH$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13382-CM$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13382-CY$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de expressão)HG13382-G$75
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13382-NF$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13382-NH$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13382-NM$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13382-NY$295
Humano IPO11/IPO-11 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13382-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG13382-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.