Encomenda rápida

Humano IL7R/IL-7R/CD127 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano IL7R Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1380bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interleukin 7 receptor with C terminal Flag tag.
Sinónimo de gene:ILRA, CD127, IL7RA, CDW127, IL-7R-alpha, IL7R
Local de restrição:KpnI + XbaI (6kb + 1.42kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
( We provide with IL7R qPCR primers for gene expression analysis, HP100936 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano IL7R Gene Plasmid Map
Human IL7Ra / CD127 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin 7 Receptor alpha (IL-7RA), also known as CD127, is a 75 kDa hematopoietin receptor superfamily member that plays an important role in lymphocyte differentiation, proliferation, and survival. IL-7 receptor alpha (CD127) signaling is essential for T-cell development and regulation of naive and memory T-cell homeostasis. IL-7RA is critically required for the proper development and function of lymphoid cells. Therefore, the IL-7RA is critically required for the proper development and function of lymphoid cells. Studies from both pathogenic and controlled HIV infection indicate that the containment of immune activation and preservation of CD127 expression are critical to the stability of CD4(+) T cells in infection. A better understanding of the factors regulating CD127 expression in HIV disease, particularly on T(CM) cells, might unveil new approaches exploiting the IL-7/IL-7R receptor pathway to restore T cell homeostasis and promote immune reconstitution in HIV infection. Factors relevant to HIV infection that could potentially decrease CD127 expression on human CD8(+) T cells. CD127 down-regulation may be an important contributor to HIV-associated T-cell dysfunction. In addition to IL-7, IL-7RA also associates with TSLPR to form the functional receptor for thymic stromal lymphopoietin (TSLP) which indirectly regulates T cell development by modulating dendritic cell activation. Mutations in the human IL-7RA gene cause a type of severe combined immunodeficiency in which the major deficiencies are in T cell development, whereas B and NK cells are relatively normal in number. Variation in the IL7RA gene was recently found associated with multiple sclerosis (MS). The polymorphisms in the IL7RA gene is involved in MS pathogenesis and suggest that IL7RA variation may primarily affect chronic disease courses. Soluble CD127 (sCD127) appears to play an important role in the immunopathogenesis of several chronic infections, multiple sclerosis, and various cancers.

  • Vranjkovic A, et al. (2007) IL-7 decreases IL-7 receptor alpha (CD127) expression and induces the shedding of CD127 by human CD8+ T cells. Int Immunol. 19(12): 1329-39.
  • Kiazyk SA, et al. (2008) Loss of CD127 expression links immune activation and CD4(+) T cell loss in HIV infection. Trends Microbiol. 16(12): 567-73.
  • Akkad DA, et al. (2009) Variation in the IL7RA and IL2RA genes in German multiple sclerosis patients. J Autoimmun. 32(2): 110-5.
  • Crawley AM, et al. (2010) Soluble IL-7R alpha (sCD127) inhibits IL-7 activity and is increased in HIV infection. J Immunol. 184(9): 4679-87.
  • Size / Price
    Catálogo: HG10975-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    • Human IL7Ra / CD127 natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.