Encomenda rápida

Humano IL-17RD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano IL17RD Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:2220bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens interleukin 17 receptor D with C terminal Flag tag.
    Sinónimo de gene:SEF, IL-17RD, IL17RLM, FLJ35755, MGC133309, DKFZp434N1928
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    ( We provide with IL17RD qPCR primers for gene expression analysis, HP100528 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name

    Interleukin-17 receptor D (IL-17D) also known as Interleukin-17 receptor-like protein, is a member of interleukine-17 recepter family. IL-17RD functions as a feedback inhibitor of fibroblast growth factor mediated Ras-MAPK signaling and ERK activation. It may inhibit FGF-induced FGFR1 tyrosine phosphorylation, regulate the nuclear ERK signaling pathway by spatially blocking nuclear translocation of activated ERK By similarity, and mediate JNK activation and may be involved in apoptosis. IL-17RD is found expressed in the neopallial cortex, rhombic lip and dorsal regions of the myelencephalon and in the frontal nasal process. IL-17RD is also expressed in the commissural plate and septal area of the forebrain and in the hippocampus, lens and optic cup. In the oral region, IL-17RD is expressed in the tongue and in the mesenchyme of the first branchial arch. It is also expressed in the developing inner ear. IL-17RD interacts with both IL-17R-Myc and IL-17RB-Myc. Both the intracellular and extracellular domains of IL-17RD interact with IL-17R. IL-17R forms a heteromeric complex with IL-17RD. Experiment results indicate that IL-17RD is able to affect IL-17R localization, suggesting that these two molecules are colocalized and associate with each other within cells. The fact that IL-17RD Delta ICD is unable to mediate IL-17 signaling but functions as a dominant-negative form indicates that the intracellular domain of IL-17RD is pivotal. In addition, IL-17RD interacts with the IL-17R downstream molecule TRAF6. It has been proposed that the IL-17RD intracellular domain interacts with IL-17R and TRAF6 to deliver the downstream signal.

  • Weaver CT, et al.. (2007) IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol. 25: 821-52.
  • Rong Z, et al.. (2009) IL-17RD (Sef or IL-17RLM) interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res. 19(2): 208-15.
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9(8): 556-67.
  • Size / Price
    Catálogo: HG10507-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.