After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IL17RB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_018725.3
Tamanho de cDNA:1509bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal Myc tag.
Sinónimo de gene:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Espécie:Human
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13091-ACG$245
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13091-ACR$245
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13091-CF$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13091-CH$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13091-CM$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13091-CY$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de expressão)HG13091-M$75
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13091-M-F$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13091-NF$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13091-NH$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13091-NM$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13091-NY$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13091-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Referências
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catálogo: HG13091-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"