Encomenda rápida

Text Size:AAA

Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human NFKBIA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:954bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha with C terminal His tag.
Sinónimo de gene:IKBA, MAD-3, IkappaBalpha
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12045-ACG$225
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12045-ACR$225
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12045-ANG$225
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12045-ANR$225
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12045-CF$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12045-CH$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12045-CM$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12045-CY$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de expressão)HG12045-G$75
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12045-NF$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12045-NH$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12045-NM$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12045-NY$195
Humano IkB alpha/NFKBIA clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12045-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.

  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
  • Size / Price
    Catálogo: HG12045-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.