Encomenda rápida

Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IGF2BP2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1800bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 mRNA binding protein 2 with C terminal His tag.
Sinónimo de gene:p62, IMP2, IMP-2, VICKZ2
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11116-ACG$245
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11116-ACR$245
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11116-ANG$245
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11116-ANR$245
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11116-CF$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11116-CH$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11116-CM$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11116-CY$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11116-M$75
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11116-M-F$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11116-NF$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11116-NH$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11116-NM$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11116-NY$215
Humano IGF2BP2/IMP2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11116-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

  • Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.
  • Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.
  • Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.
  • Size / Price
    Catálogo: HG11116-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.