After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano IFNA5/IFNaG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IFNA5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002169.1
Tamanho de cDNA:570bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interferon, alpha 5 with C terminal Flag tag.
Sinónimo de gene:IFNA5, RP11-380P16.5
Espécie:Human
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano IFNA5/IFNaG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Product nameProduct name
Fundo

Interferon, alpha 5 (IFNA5) belongs to the alpha/beta interferon family. IFNA5 is the only IFNA subtype detected in normal liver, while a mixture of subtypes is observed in the liver tissue of patients with chronic hepatitis C. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.

Referências
  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • Size / Price
    Catálogo: HG10342-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"