Encomenda rápida

Humano IFN omega clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano IFNW1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:588bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interferon, omega 1 with C terminal Flag tag.
Sinónimo de gene:IFNW1
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
( We provide with IFNW1 qPCR primers for gene expression analysis, HP100390 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano IFN omega clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Product nameProduct name

IFNs are a large family of proteins having antiviral, antiproliferative, and immunomodulatory effects, and are divided into two major classes, type I  and type I I, on the basis of differences in receptor binding and nucleotide sequence. Type I IFNs consist of IFN α, β, τ, and ω and bind to the type I  IFN receptor, whereas IFN-γ is the only type I I IFN and is specific for the type I I IFN receptor. Human IFN-ω, was identified by three independent groups in 1985 and is structurally related to IFN-α and -β. Both human IFN-ω and IFN-α are produced by virally induced leukocytes and have similar antiviral activities on human cell lines, and a sizeable proportion (at least 10%) of the total antiviral activity of leukocyte IFN is contributed by IFN-ωl. In addition, it was reported that IFN-ω could inhibit the growth of human tumors in vivo.

Size / Price
Catálogo: HG10353-CF
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.