Encomenda rápida

Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano IFNA8 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_002170.3
    Tamanho de cDNA:570bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens interferon, alpha 8 with C terminal Flag tag.
    Sinónimo de gene:IFNA8
    Espécie:Human
    Vetor:pCMV3-C-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IFNA8 qPCR primers for gene expression analysis, HP100385 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10347-ACG$225
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10347-ACR$225
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10347-CF$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10347-CH$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10347-CM$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10347-CY$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10347-M$75
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10347-M-F$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10347-NF$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10347-NH$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10347-NM$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10347-NY$195
    Humano Interferon alpha-B / IFNA8 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10347-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.

    Referências
  • Henco K. et al., 1985, J Mol Biol. 185 (2): 227-60.
  • Goeddel DV. et al., 1981, Nature. 290 (5801): 20-6.
  • Yelverton E. et al., 1981, Nucleic Acids Res. 9 (3): 731-41.
  • Kempaiah P. et al., 2012, Hum Genet. 131 (8): 1375-91.
  • Size / Price
    Catálogo: HG10347-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"