After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IFNA1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC112300
Tamanho de cDNA:570bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interferon, alpha 1 with N terminal His tag.
Sinónimo de gene:IFL, IFN, IFNA@, IFNA13, IFN-ALPHA, IFN-alphaD
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12341-ACG$225
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12341-ACR$225
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12341-CF$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12341-CH$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12341-CM$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12341-CY$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de expressão)HG12341-G$75
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12341-G-N$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12341-NF$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12341-NH$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12341-NM$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12341-NY$195
Humano IFN-alpha / IFNA1 / IFN clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12341-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

Referências
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Size / Price
    Catálogo: HG12341-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"