Encomenda rápida

Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

  • Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano IFIH1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC046208
Tamanho de cDNA:711 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interferon induced with helicase C domain 1 with N terminal His tag.
Sinónimo de gene:Hlcd, MDA5, MDA-5, RLR-2, IDDM19
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:pCMV3-His-IFIH1
Local de restrição:KpnI + XbaI(6kb+0.71kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IFIH1 qPCR primers for gene expression analysis, HP104013 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15389-ACG$225
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15389-ACR$225
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15389-ANG$225
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15389-ANR$225
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15389-CF$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15389-CH$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15389-CM$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15389-CY$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15389-G$75
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15389-NF$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15389-NH$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15389-NM$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15389-NY$195
Humano MDA5/IFIH1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15389-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15389-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"