After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano IFI30 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IFI30 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_006332.4
Tamanho de cDNA:753bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens interferon, gamma-inducible protein 30 with N terminal Flag tag.
Sinónimo de gene:GILT, IP30, IFI-30
Espécie:Human
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fundo

IFI30 belongs to the GILT family. This family includes the two characterised human gamma-interferon-inducible lysosomal thiol reductase (GILT) sequences: P13284 and Q9UL08. It also contains several other eukaryotic putative proteins with similarity to GILT. The aligned region contains three conserved cysteine residues. In addition, the two GILT sequences possess a C-X(2)-C motif that is shared by some of the other sequences in the family. This motif is thought to be associated with disulphide bond reduction. IFI30 is a lysosomal thiol reductase that can reduce protein disulfide bonds. It facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. It also facilitates MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. IFI30 may facilitate the complete unfolding of proteins destined for lysosomal degradation and plays an important role in antigen processing.

Referências
  • Haque MA, et al. (2002) Absence of gamma-Interferon-inducible Lysosomal Thiol Reductase in Melanomas Disrupts T Cell Recognition of Select Immunodominant Epitopes. J Exp Med. 195(10):1267-77.
  • Phan UT, et al. (2000) Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action. J Biol Chem. 275(34):25907-14.
  • Phan UT, et al. (2001) Multiple species express thiol oxidoreductases related to GILT. Immunogenetics. 53(4):342-6.
  • Size / Price
    Catálogo: HG16347-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"