After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human IDS Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1653bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens iduronate 2-sulfatase, transcript variant 1 with C terminal Flag tag.
Sinónimo de gene:MPS2, SIDS
Local de restrição:KpnI + XbaI (6kb + 1.69kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human IDS Gene Plasmid Map
Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10337-ACG$245
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10337-ACR$245
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10337-CF$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10337-CH$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10337-CM$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10337-CY$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10337-M$75
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10337-NF$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10337-NH$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10337-NM$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10337-NY$215
Humano Iduronate 2-Sulfatase / IDS transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10337-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Size / Price
Catálogo: HG10337-CF
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.