Encomenda rápida

Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

  • Human IDH1 natural ORF mammalian expression plasmid, C-His tag
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano IDH1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_005896.2
Tamanho de cDNA:1245bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens isocitrate dehydrogenase 1 (NADP+), soluble with C terminal His tag.
Sinónimo de gene:IDH, IDP, IDCD, IDPC, PICD, IDH1
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:pCMV3-IDH1-His
Local de restrição:KpnI + XbaI (6kb + 1.29kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IDH1 qPCR primers for gene expression analysis, HP100077 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano IDH1 Gene Plasmid Map
Human IDH1 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12055-ACG$225
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12055-ACR$225
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12055-ANG$225
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12055-ANR$225
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12055-CF$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12055-CH$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12055-CM$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12055-CY$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12055-G$75
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12055-G-Y$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12055-NF$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12055-NH$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12055-NM$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12055-NY$195
Humano IDH1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12055-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Referências
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"