Encomenda rápida

Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

  • Human Insulysin/insulin-degrading enzyme Gene Plasmid Map 15908
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano IDE Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC096336
Tamanho de cDNA:3105 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens insulin-degrading enzyme with N terminal His tag.
Sinónimo de gene:INSULYSIN
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:pCMV3-His-IDE
Local de restrição:KpnI(two restriction sites) + XbaI(6kb+3.06kb+0.06kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IDE qPCR primers for gene expression analysis, HP104565 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15978-ACG$325
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15978-ACR$325
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15978-CF$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15978-CH$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15978-CM$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15978-CY$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de expressão)HG15978-G$75
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15978-NF$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15978-NH$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15978-NM$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15978-NY$295
Humano Insulysin/insulin-degrading enzyme clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15978-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15978-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"