GRP94 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16275-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GRP94 Reagents

CRO Services

Product recommended


All GRP94 Reagents

GRP94 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2451 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human heat shock protein 90kDa beta (Grp94), member 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(three restriction sites) + XbaI(6kb+0.50kb+0.98kb+0.99kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRP94 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRP94 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human HSP90B1 Gene Plasmid Map 18996

GRP94 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

ECGP cDNA ORF Clone, Human;GP96 cDNA ORF Clone, Human;GRP94 cDNA ORF Clone, Human;HEL-S-125m cDNA ORF Clone, Human;HEL35 cDNA ORF Clone, Human;TRA1 cDNA ORF Clone, Human

GRP94 Background Information

Full Name
heat shock protein 90kDa beta (Grp94), member 1

GRP94 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRP94 cDNA ORF Clone in Cloning Vector, Mouse MG52996-G
GRP94 cDNA ORF Clone, Mouse, untagged MG52996-UT
GRP94 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52996-ACGLN
GRP94 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52996-ACG
GRP94 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52996-ACR
GRP94 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52996-CF
GRP94 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52996-NF
GRP94 cDNA ORF Clone, Mouse, C-His tag MG52996-CH
GRP94 cDNA ORF Clone, Mouse, N-His tag MG52996-NH
GRP94 cDNA ORF Clone, Mouse, C-HA tag MG52996-CY
GRP94 cDNA ORF Clone, Mouse, N-HA tag MG52996-NY
GRP94 cDNA ORF Clone, Mouse, C-Myc tag MG52996-CM
GRP94 cDNA ORF Clone, Mouse, N-Myc tag MG52996-NM

GRP94 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRP94 cDNA ORF Clone in Cloning Vector, Human HG16275-G
GRP94 cDNA ORF Clone, Human, untagged HG16275-UT
GRP94 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16275-ACGLN
GRP94 cDNA ORF Clone, Human, C-GFPSpark® tag HG16275-ACG
GRP94 cDNA ORF Clone, Human, C-OFPSpark® tag HG16275-ACR
GRP94 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16275-NF
GRP94 cDNA ORF Clone, Human, C-His tag HG16275-CH
GRP94 cDNA ORF Clone, Human, N-His tag HG16275-NH
GRP94 cDNA ORF Clone, Human, C-HA tag HG16275-CY
GRP94 cDNA ORF Clone, Human, N-HA tag HG16275-NY
GRP94 cDNA ORF Clone, Human, C-Myc tag HG16275-CM
GRP94 cDNA ORF Clone, Human, N-Myc tag HG16275-NM
info info
添加购物车成功! 添加购物车失败!