Encomenda rápida

Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano HSF1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC014638
    Tamanho de cDNA:1590bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens heat shock transcription factor 1 with C terminal HA tag.
    Sinónimo de gene:HSTF1, HSF1
    Espécie:Human
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSF1 qPCR primers for gene expression analysis, HP101902 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12245-ACG$245
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12245-ACR$245
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12245-ANG$245
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12245-ANR$245
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12245-CF$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12245-CH$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12245-CM$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12245-CY$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12245-G$75
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12245-G-N$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12245-NF$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12245-NH$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12245-NM$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12245-NY$215
    Humano HSF1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12245-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Heat shock factor protein 1, also known as heat shock transcription factor 1, HSF1 and HSTF1, is a cytoplasm and nucleus protein which belongs to the HSF family. HSF1 is the major transcription factor of HSPs (heat shock proteins) in response to various stresses. Wild type HSF1 (heat shock transcriptional factor 1) is normally inactive. HSF1 / HSTF1 is a DNA-binding protein that specifically binds heat shock promoter elements (HSE) and activates transcription. In higher eukaryotes, HSF is unable to bind to the HSE unless the cells are heat shocked. HSF1 / HSTF1 protects cells and organisms against various types of stress, either by triggering a complex response that promotes cell survival or by triggering cell death when stress-induced alterations cannot be rescued. HSF1 / HSTF1 is the key protein in regulating stress response. It can be activated under heat, oxidative or another stress conditions. Dominant-positive and dominant-negative HSF1 are two types of HSF1 mutants. Both of them gain the DNA binding activity in the absence of stress. In addition, dominant-positive HSF1 acquires transcriptional activity, which dominant-negative HSF1 does not acquire. HSF1 / HSTF1 was also reported to contribute to cell resistance against genotoxic stress, such as that caused by doxorubicin, an anticancer drug in common clinical use.

    Referências
  • Holmberg,C.I. et al., 2000, Cell Stress Chaperones.5 (3):219-28.
  • Huang,Y.H. et al., 2007, Sheng Wu Gong Cheng Xue Bao. 23 (6): 971-5.
  • Salmand,P.A. et al.,2008, Biol Reprod  79 (6): 1092-101.
  • Lee,Y.J. et al., 2008, Cancer Res  68 (18): 7550-60.
  • Hou,Y. et al., 2009, Mol Biol Rep. 36 (8): 2271-7.
  • Size / Price
    Catálogo: HG12245-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"